Detail of EST/Unigene CX530597 |
Acc. | CX530597 |
Internal Acc. | s13dNF57D04MJ031_247210 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase parA OS=Nicotiana tabacum E-value=3e-79; Glutathione S-transferase U20 OS=Arabidopsis thaliana E-value=3e-73; Probable glutathione S-transferase parC OS=Nicotiana tabacum E-value=5e-73; Glutathione S-transferase U25 OS=Arabidopsis thaliana E-value=2e-72; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=3e-72; |
Length | 635 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | GTTTTGTTGGATTTTTGGCCAAGCGTATATGGAATGAGAGTGAAAATTGCTTTGGAAGAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 844173 |
Trichome-related Gene from Literature | N/A |