Detail of EST/Unigene CX530673 |
Acc. | CX530673 |
Internal Acc. | s13dNF58D02MJ015_247362 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Linoleate 9S-lipoxygenase OS=Lens culinaris E-value=1e-80; Linoleate 9S-lipoxygenase-4 OS=Glycine max E-value=7e-71; Seed linoleate 9S-lipoxygenase-3 OS=Glycine max E-value=2e-70; Linoleate 9S-lipoxygenase (Fragment) OS=Phaseolus vulgaris E-value=3e-70; Seed linoleate 9S-lipoxygenase-3 OS=Pisum sativum E-value=5e-67; |
Length | 469 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CCCACTCTTTCCATATTTGAGGAAAATAAATGCAACCGAGACTAAGGCCTATGCTACTAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00458 arachidonate 12-lipoxygenase; ; Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K08022 arachidonate 15-lipoxygenase (second type) / 8-lipoxygenase (S-type) |
EC | 1.13.11.- 1.13.11.33 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821808 |
Trichome-related Gene from Literature | N/A |