Detail of EST/Unigene CX530752 |
Acc. | CX530752 |
Internal Acc. | s13dNF27E05MJ036_247519 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Cullin-1 OS=Arabidopsis thaliana E-value=0; Putative cullin-like protein 1 OS=Arabidopsis thaliana E-value=3e-77; Cullin-2 OS=Arabidopsis thaliana E-value=2e-74; Putative cullin-like protein 2 OS=Arabidopsis thaliana E-value=1e-73; Cullin-like protein 3 OS=Arabidopsis thaliana E-value=2e-65; |
Length | 630 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | TGAACCTCAATTCAGTCCTGAAGATTATATGATGCTGTACACAACTATATACAATATGTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03347 cullin 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03347 cullin 1; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03869 cullin 3 |
EC | 6.3.2.19 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825648 |
Trichome-related Gene from Literature | N/A |