| Detail of EST/Unigene CX531000 |
| Acc. | CX531000 |
| Internal Acc. | s13dNF20D08MJ063_248140 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Betaine aldehyde dehydrogenase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-28; Betaine aldehyde dehydrogenase, chloroplastic OS=Amaranthus hypochondriacus E-value=1e-26; Betaine aldehyde dehydrogenase, chloroplastic OS=Beta vulgaris E-value=5e-26; Betaine aldehyde dehydrogenase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-23; Betaine aldehyde dehydrogenase, chloroplastic OS=Atriplex hortensis E-value=5e-23; |
| Length | 309 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | GTAGAAAAATGGATATTCCGATCCCGTCTCGACAGTTATTCATTAACGGTGACTGGAAAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | 1.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 843831 |
| Trichome-related Gene from Literature | N/A |