Detail of EST/Unigene CX531000 |
Acc. | CX531000 |
Internal Acc. | s13dNF20D08MJ063_248140 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Betaine aldehyde dehydrogenase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-28; Betaine aldehyde dehydrogenase, chloroplastic OS=Amaranthus hypochondriacus E-value=1e-26; Betaine aldehyde dehydrogenase, chloroplastic OS=Beta vulgaris E-value=5e-26; Betaine aldehyde dehydrogenase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-23; Betaine aldehyde dehydrogenase, chloroplastic OS=Atriplex hortensis E-value=5e-23; |
Length | 309 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | GTAGAAAAATGGATATTCCGATCCCGTCTCGACAGTTATTCATTAACGGTGACTGGAAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.2.1.3 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 843831 |
Trichome-related Gene from Literature | N/A |