| Detail of EST/Unigene CX531026 |
| Acc. | CX531026 |
| Internal Acc. | s13dNF20G07MJ053_248192 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | ATP sulfurylase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-77; ATP sulfurylase 4, chloroplastic OS=Arabidopsis thaliana E-value=3e-71; ATP-sulfurylase 3, chloroplastic OS=Arabidopsis thaliana E-value=3e-71; ATP sulfurylase 2 OS=Arabidopsis thaliana E-value=2e-60; Bifunctional 3'-phosphoadenosine 5'-phosphosulfate synthase 1 OS=Cavia porcellus E-value=5e-36; |
| Length | 633 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | AATGGCTTCCATGGCTACCCTTTTGTCCAAAACCTCTTTCCCTTCTCACTCTCTCTTCAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00860 adenylylsulfate kinase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00860 adenylylsulfate kinase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00860 adenylylsulfate kinase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K00958 sulfate adenylyltransferase; Metabolism > Nucleotide Metabolism > ko00230 Purine metabolism > K00958 sulfate adenylyltransferase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00958 sulfate adenylyltransferase |
| EC | 2.7.1.25 2.7.7.4 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821861 |
| Trichome-related Gene from Literature | N/A |