Detail of EST/Unigene CX531200 |
Acc. | CX531200 |
Internal Acc. | s13dNF31C08MJ055_248524 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=3e-06; |
Length | 126 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | ATCGATTAATCTTGTAAATTATGGCAACAATAAAAGTCCATGGAAGTCCCTACTCAACGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819386 |
Trichome-related Gene from Literature | 819386 |