| Detail of EST/Unigene CX531248 |
| Acc. | CX531248 |
| Internal Acc. | s13dNF24B08MJ062_248613 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | SKP1-like protein 1B OS=Arabidopsis thaliana E-value=9e-60; SKP1-like protein 1A OS=Arabidopsis thaliana E-value=6e-58; SKP1-like protein 4 OS=Arabidopsis thaliana E-value=3e-50; SKP1-like protein 11 OS=Arabidopsis thaliana E-value=1e-48; SKP1-like protein 12 OS=Arabidopsis thaliana E-value=1e-47; |
| Length | 622 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CGATTTCACAAACACCGTTTCCAAATTCTCATCCAAACCCTAATCAATCACGATCACGAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04350 TGF-beta signaling pathway > K03094 S-phase kinase-associated protein 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03094 S-phase kinase-associated protein 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834224 |
| Trichome-related Gene from Literature | N/A |