Detail of EST/Unigene CX531458 |
Acc. | CX531458 |
Internal Acc. | s13dNF34E05MJ036_256866 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Isoflavone 2'-hydroxylase OS=Glycyrrhiza echinata E-value=1e-60; Cytochrome P450 81D1 OS=Arabidopsis thaliana E-value=1e-59; Cytochrome P450 81F1 OS=Arabidopsis thaliana E-value=6e-49; Cytochrome P450 93A1 OS=Glycine max E-value=2e-37; Flavonoid 3'-monooxygenase OS=Arabidopsis thaliana E-value=8e-36; |
Length | 621 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | ACACATCATCCGTAACAATAGAATGGGCTATGTCCAATTTACTAAACCATCCAGAAATAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1 |
EC | 1.14.14.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829888 |
Trichome-related Gene from Literature | N/A |