Detail of EST/Unigene CX531567 |
Acc. | CX531567 |
Internal Acc. | s13dNF29A11MJ082_257080 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Acetolactate synthase 3, chloroplastic OS=Brassica napus E-value=1e-73; Acetolactate synthase 1, chloroplastic OS=Brassica napus E-value=1e-73; Acetolactate synthase, chloroplastic OS=Arabidopsis thaliana 1.2 E-value=3e-72; Acetolactate synthase 2, chloroplastic OS=Nicotiana tabacum SURB E-value=3e-71; Acetolactate synthase 1, chloroplastic OS=Nicotiana tabacum SURA E-value=4e-71; |
Length | 627 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | ATGGCAGCCACTGCTGCAAAAGCCGCGTTCACAACCACCATCTCTTCCTCTTCACCACAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 4.1.-.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 824015 |
Trichome-related Gene from Literature | N/A |