Detail of EST/Unigene CX531583 |
Acc. | CX531583 |
Internal Acc. | s13dNF29C09MJ067_257112 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Quinone oxidoreductase-like protein At1g23740, chloroplastic OS=Arabidopsis thaliana E-value=9e-56; Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=7e-10; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=6e-09; Reticulon-4-interacting protein 1, mitochondrial OS=Bos taurus E-value=1e-08; Reticulon-4-interacting protein 1, mitochondrial OS=Mus musculus E-value=2e-08; |
Length | 606 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | TTATGGTGATATCAATGAGATTACTTTACACAATCCAAAAACTATTGGTACTTTGTCAGA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.-.-.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 838984 |
Trichome-related Gene from Literature | N/A |