| Detail of EST/Unigene CX531638 |
| Acc. | CX531638 |
| Internal Acc. | s13dNF80B10MJ077_257221 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aconitate hydratase (Fragment) OS=Cucumis melo var. conomon E-value=3e-09; Aconitate hydratase, cytoplasmic OS=Cucurbita maxima E-value=3e-09; Aconitate hydratase 2, mitochondrial OS=Arabidopsis thaliana E-value=3e-09; Aconitate hydratase 1 OS=Arabidopsis thaliana E-value=3e-09; Putative aconitate hydratase, cytoplasmic OS=Oryza sativa subsp. japonica E-value=1e-08; |
| Length | 83 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | GATTACTCTATCCTGACAGTGTGGTTGGGACTGATTCCCATACAACTATGATTGATGGGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00020 Citrate cycle (TCA cycle) > K01681 aconitate hydratase 1; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K01681 aconitate hydratase 1; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01681 aconitate hydratase 1 |
| EC | 4.2.1.3 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 829737 |
| Trichome-related Gene from Literature | N/A |