| Detail of EST/Unigene CX531724 |
| Acc. | CX531724 |
| Internal Acc. | s13dNF81F02MJ015_257390 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=9e-35; Nudix hydrolase 13, mitochondrial OS=Arabidopsis thaliana E-value=5e-34; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=4e-27; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=9e-22; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=2e-20; |
| Length | 628 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CATGCTGTGGAAAAGAAAGAAAAAACAGCAAACCATTCTCATGAAAATTGTTTCTTTCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837845 |
| Trichome-related Gene from Literature | N/A |