Detail of EST/Unigene CX531724 |
Acc. | CX531724 |
Internal Acc. | s13dNF81F02MJ015_257390 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Nudix hydrolase 12, mitochondrial OS=Arabidopsis thaliana E-value=9e-35; Nudix hydrolase 13, mitochondrial OS=Arabidopsis thaliana E-value=5e-34; Nudix hydrolase 16, mitochondrial OS=Arabidopsis thaliana E-value=4e-27; Nudix hydrolase 17, mitochondrial OS=Arabidopsis thaliana E-value=9e-22; Nudix hydrolase 4 OS=Arabidopsis thaliana E-value=2e-20; |
Length | 628 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CATGCTGTGGAAAAGAAAGAAAAAACAGCAAACCATTCTCATGAAAATTGTTTCTTTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 837845 |
Trichome-related Gene from Literature | N/A |