| Detail of EST/Unigene CX531784 |
| Acc. | CX531784 |
| Internal Acc. | s13dNF87D03MJ026_257510 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | 5'-adenylylsulfate reductase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; 5'-adenylylsulfate reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; 5'-adenylylsulfate reductase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-17; Probable 5'-adenylylsulfate reductase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-16; |
| Length | 640 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | GCAAGCCCTGGCAAAACCCTAGATTACTTTGTGTTTATATTTACTGAAATTGCCCCTTCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 842514 |
| Trichome-related Gene from Literature | N/A |