Detail of EST/Unigene CX531784 |
Acc. | CX531784 |
Internal Acc. | s13dNF87D03MJ026_257510 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | 5'-adenylylsulfate reductase 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-18; 5'-adenylylsulfate reductase 1, chloroplastic OS=Arabidopsis thaliana E-value=5e-18; 5'-adenylylsulfate reductase 3, chloroplastic OS=Arabidopsis thaliana E-value=2e-17; Probable 5'-adenylylsulfate reductase 1, chloroplastic OS=Oryza sativa subsp. japonica E-value=2e-16; |
Length | 640 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | GCAAGCCCTGGCAAAACCCTAGATTACTTTGTGTTTATATTTACTGAAATTGCCCCTTCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 842514 |
Trichome-related Gene from Literature | N/A |