Detail of EST/Unigene CX532556 |
Acc. | CX532556 |
Internal Acc. | s13dNF73E06MJ039_271399 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Hydroxymethylglutaryl-CoA synthase OS=Arabidopsis thaliana E-value=0; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Pongo abelii E-value=5e-76; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Homo sapiens E-value=6e-76; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Gallus gallus E-value=2e-75; Hydroxymethylglutaryl-CoA synthase, cytoplasmic OS=Mus musculus E-value=3e-75; |
Length | 610 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | TGATGGTGCTAGTAAAGGGAAATATACAATTGGACTTGGACAAGATTGCATGTCATTTTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00650 Butanoate metabolism > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Lipid Metabolism > ko00072 Synthesis and degradation of ketone bodies > K01641 hydroxymethylglutaryl-CoA synthase; Metabolism > Amino Acid Metabolism > ko00280 Valine, leucine and isoleucine degradation > K01641 hydroxymethylglutaryl-CoA synthase |
EC | 2.3.3.10 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826788 |
Trichome-related Gene from Literature | 826788 |