Detail of EST/Unigene CX532637 |
Acc. | CX532637 |
Internal Acc. | s13dNF88G10MJ072_271559 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic OS=Solanum tuberosum E-value=9e-54; Transketolase, chloroplastic OS=Spinacia oleracea E-value=8e-53; Transketolase, chloroplastic OS=Zea mays E-value=2e-52; Transketolase 7 OS=Craterostigma plantagineum E-value=2e-47; Transketolase 10 OS=Craterostigma plantagineum E-value=1e-42; |
Length | 632 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | ACCACCTACATATTCTATCTAATCCCAACAACACTCTTACTACTATTACTTTACTTACTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00030 Pentose phosphate pathway > K00615 transketolase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K00615 transketolase; Metabolism > Biosynthesis of Polyketides and Nonribosomal Peptides > ko01051 Biosynthesis of ansamycins > K00615 transketolase |
EC | 2.2.1.1 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825246 |
Trichome-related Gene from Literature | N/A |