Detail of EST/Unigene CX532765 |
Acc. | CX532765 |
Internal Acc. | s13dNF71B02MJ013_271813 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Beta-glucosidase 11 OS=Oryza sativa subsp. japonica E-value=7e-30; Beta-glucosidase 10 OS=Oryza sativa subsp. japonica E-value=2e-29; Beta-glucosidase 13 OS=Oryza sativa subsp. japonica E-value=6e-29; Beta-glucosidase 12 OS=Oryza sativa subsp. japonica E-value=1e-27; Isoflavonoid 7-O-beta-apiosyl-glucoside beta-glycosidase OS=Dalbergia nigrescens E-value=2e-26; |
Length | 634 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CAATGATCCAACGCTATCACTGGAAGAGGCACTCATGGATACTAACAGAATTGATTACTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K01229 lactase; Metabolism > Biosynthesis of Secondary Metabolites > ko00940 Phenylpropanoid biosynthesis > K05350 beta-glucosidase; Metabolism > Carbohydrate Metabolism > ko00500 Starch and sucrose metabolism > K05350 beta-glucosidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K05350 beta-glucosidase |
EC | 3.2.1.108 3.2.1.21 3.2.1.62 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 833656 |
Trichome-related Gene from Literature | N/A |