Detail of EST/Unigene CX532921 |
Acc. | CX532921 |
Internal Acc. | s13dNF69A10MJ069_272122 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Chorismate synthase, chloroplastic OS=Arabidopsis thaliana E-value=3e-58; Chorismate synthase 1, chloroplastic OS=Solanum lycopersicum E-value=4e-57; Chorismate synthase 2, chloroplastic OS=Solanum lycopersicum E-value=8e-57; Chorismate synthase, chloroplastic OS=Corydalis sempervirens E-value=5e-55; Chorismate synthase OS=Cyanothece sp. (strain ATCC 51142) E-value=1e-43; |
Length | 585 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CAAACATCAAACAAAGATTATTTCATTTCATTTCCCAATAGCCATAGCAATAGCCATGGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841307 |
Trichome-related Gene from Literature | N/A |