Detail of EST/Unigene CX532937 |
Acc. | CX532937 |
Internal Acc. | s13dNF69C05MJ034_272154 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Putative quinone-oxidoreductase homolog, chloroplastic OS=Arabidopsis thaliana E-value=5e-61; Quinone-oxidoreductase homolog, chloroplastic OS=Spinacia oleracea E-value=3e-58; Quinone oxidoreductase-like protein At1g23740, chloroplastic OS=Arabidopsis thaliana E-value=2e-21; Reticulon-4-interacting protein 1 homolog, mitochondrial OS=Danio rerio E-value=2e-19; Reticulon-4-interacting protein 1, mitochondrial OS=Homo sapiens E-value=3e-19; |
Length | 507 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CATCTGGATTGAAGCATGTTGAAGTTCCAATTCCAACTCCAAAGACCAATGAAGTTTTAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.6.5.5 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 826914 |
Trichome-related Gene from Literature | N/A |