| Detail of EST/Unigene CX532948 |
| Acc. | CX532948 |
| Internal Acc. | s13dNF69D06MJ046_272176 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Dual specificity mitogen-activated protein kinase kinase 1 OS=Dictyostelium discoideum E-value=2e-18; Mitogen-activated protein kinase kinase 6 OS=Arabidopsis thaliana E-value=2e-17; Mitogen-activated protein kinase kinase 2 OS=Arabidopsis thaliana E-value=9e-17; Dual specificity mitogen-activated protein kinase kinase dSOR1 OS=Drosophila melanogaster E-value=2e-16; Mitogen-activated protein kinase kinase 1 OS=Arabidopsis thaliana E-value=2e-14; |
| Length | 633 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | TTTTGATTCAACAATGTCTGGTTTAGAAGAATTGAGAAAAAAACTTACACCTTTATTTGA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04368 mitogen-activated protein kinase kinase 1; Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K04369 mitogen-activated protein kinase kinase 2; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04369 mitogen-activated protein kinase kinase 2; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04369 mitogen-activated protein kinase kinase 2 |
| EC | 2.7.11.- 2.7.11.24 2.7.12.2 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 834042 |
| Trichome-related Gene from Literature | N/A |