| Detail of EST/Unigene CX532973 |
| Acc. | CX532973 |
| Internal Acc. | s13dNF69G09MJ068_272225 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glucan endo-1,3-beta-glucosidase, basic isoform OS=Phaseolus vulgaris E-value=4e-79; Glucan endo-1,3-beta-glucosidase OS=Pisum sativum E-value=8e-78; Lichenase OS=Nicotiana plumbaginifolia E-value=6e-60; Glucan endo-1,3-beta-glucosidase, basic vacuolar isoform OS=Hevea brasiliensis E-value=1e-58; Glucan endo-1,3-beta-glucosidase B OS=Solanum lycopersicum E-value=9e-58; |
| Length | 600 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CAACAGGAATGTAATGGCTTCTCTACTGCTACTATTTGCTCTGTTTACAGTAAATCTTCG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827320 |
| Trichome-related Gene from Literature | N/A |