Detail of EST/Unigene CX533211 |
Acc. | CX533211 |
Internal Acc. | s13dNF0DD05MJ042_319585 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Aspartate aminotransferase OS=Thermus thermophilus (strain HB8 / ATCC 27634 / DSM 579) E-value=3e-15; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Arabidopsis thaliana E-value=5e-15; Aspartate aminotransferase OS=Thermus aquaticus E-value=5e-15; Bifunctional aspartate aminotransferase and glutamate/aspartate-prephenate aminotransferase OS=Petunia hybrida E-value=2e-13; Aspartate aminotransferase OS=Streptomyces virginiae E-value=1e-11; |
Length | 669 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | TTTTTTCTTTGGTTTTGGTTTTTGAGTGAAAAGAAAGATGGGTTCTTATGGAAATCTTGC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K00816 kynurenine-oxoglutarate transaminase; Metabolism > Amino Acid Metabolism > ko00300 Lysine biosynthesis > K00825 2-aminoadipate transaminase; Metabolism > Amino Acid Metabolism > ko00310 Lysine degradation > K00825 2-aminoadipate transaminase |
EC | 2.6.1.- |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844376 |
Trichome-related Gene from Literature | N/A |