Detail of EST/Unigene CX533224 |
Acc. | CX533224 |
Internal Acc. | s13dNF0DF07MJ059_319611 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Protoporphyrinogen oxidase, chloroplastic OS=Arabidopsis thaliana E-value=9e-66; Protoporphyrinogen oxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=8e-64; Protoporphyrinogen oxidase, chloroplastic OS=Nicotiana tabacum E-value=3e-59; Protoporphyrinogen oxidase, mitochondrial OS=Nicotiana tabacum E-value=2e-10; Protoporphyrinogen oxidase OS=Myxococcus xanthus E-value=2e-10; |
Length | 424 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | GTTTTATTATCCTCCAGTTGCCGCAGTTTCCATTTCCTATCCAAAAGAAGCCATTAGATC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827991 |
Trichome-related Gene from Literature | N/A |