Detail of EST/Unigene CX533391 |
Acc. | CX533391 |
Internal Acc. | s13dNF0BB04MJ029_319942 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Transketolase, chloroplastic (Fragment) OS=Craterostigma plantagineum E-value=5e-54; Transketolase, chloroplastic OS=Spinacia oleracea E-value=7e-51; Transketolase, chloroplastic OS=Zea mays E-value=6e-50; Transketolase, chloroplastic OS=Solanum tuberosum E-value=8e-50; Transketolase 7 OS=Craterostigma plantagineum E-value=9e-46; |
Length | 634 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | TGGATTTAACAATGTCAACTCAATCGGTTGAAAAGTTTACTATTTCGTAAAAATTTATTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 819137 |
Trichome-related Gene from Literature | N/A |