| Detail of EST/Unigene CX533575 |
| Acc. | CX533575 |
| Internal Acc. | s13dNF0HB03MJ025_320303 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Probable aminotransferase TAT2 OS=Arabidopsis thaliana E-value=4e-29; Tyrosine aminotransferase OS=Arabidopsis thaliana E-value=3e-25; Nicotianamine aminotransferase A OS=Hordeum vulgare E-value=5e-22; Nicotianamine aminotransferase B OS=Hordeum vulgare E-value=4e-21; S-alkyl-thiohydroximate lyase SUR1 OS=Arabidopsis thaliana E-value=1e-18; |
| Length | 533 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | AGACAGAAGAGGTTTTCTTCAGAAAAACCATTGACAAATTGAGGCATACCGCAGATATAT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Biosynthesis of Secondary Metabolites > ko00950 Alkaloid biosynthesis I > K00815 tyrosine aminotransferase; Metabolism > Biosynthesis of Secondary Metabolites > ko00401 Novobiocin biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00360 Phenylalanine metabolism > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00400 Phenylalanine, tyrosine and tryptophan biosynthesis > K00815 tyrosine aminotransferase; Metabolism > Amino Acid Metabolism > ko00350 Tyrosine metabolism > K00815 tyrosine aminotransferase |
| EC | 2.6.1.5 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 835480 |
| Trichome-related Gene from Literature | N/A |