Detail of EST/Unigene CX533594 |
Acc. | CX533594 |
Internal Acc. | s13dNF0HC12MJ086_320341 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable beta-1,3-galactosyltransferase 10 OS=Arabidopsis thaliana E-value=4e-68; Probable beta-1,3-galactosyltransferase 9 OS=Arabidopsis thaliana E-value=1e-66; Probable beta-1,3-galactosyltransferase 11 OS=Arabidopsis thaliana E-value=5e-31; Probable beta-1,3-galactosyltransferase 8 OS=Arabidopsis thaliana E-value=6e-16; Probable beta-1,3-galactosyltransferase 2 OS=Arabidopsis thaliana E-value=1e-14; |
Length | 563 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CAACATCGTCGTCGAAGCGAGGTGGAGGAGGAGGAAGATCAAAAATCGTTCAAACATCAA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829344 |
Trichome-related Gene from Literature | N/A |