| Detail of EST/Unigene CX533673 |
| Acc. | CX533673 |
| Internal Acc. | s13dNF0KD07MJ058_320497 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Proline--tRNA ligase OS=Plasmodium falciparum (isolate 3D7) E-value=8e-31; Bifunctional glutamate/proline--tRNA ligase OS=Mus musculus E-value=5e-29; Bifunctional glutamate/proline--tRNA ligase OS=Homo sapiens E-value=2e-28; Putative proline--tRNA ligase C19C7.06 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=4e-25; Bifunctional glutamate/proline--tRNA ligase OS=Drosophila melanogaster E-value=7e-25; |
| Length | 633 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | AGAATGTTGCAGCTATGCAAAGCTTGAAGCAGCGCCGCCGTGAAACCAAGCAGCGCCGCC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00330 Arginine and proline metabolism > K01881 prolyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01881 prolyl-tRNA synthetase; Metabolism > Amino Acid Metabolism > ko00251 Glutamate metabolism > K01885 glutamyl-tRNA synthetase; Metabolism > Metabolism of Cofactors and Vitamins > ko00860 Porphyrin and chlorophyll metabolism > K01885 glutamyl-tRNA synthetase; Genetic Information Processing > Translation > ko00970 Aminoacyl-tRNA biosynthesis > K01885 glutamyl-tRNA synthetase |
| EC | 6.1.1.15 6.1.1.17 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 825385 |
| Trichome-related Gene from Literature | N/A |