| Detail of EST/Unigene CX533688 |
| Acc. | CX533688 |
| Internal Acc. | s13dNF0KF03MJ027_320527 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Acyl-coenzyme A oxidase 2, peroxisomal OS=Arabidopsis thaliana E-value=1e-52; Acyl-coenzyme A oxidase, peroxisomal OS=Cucurbita maxima E-value=2e-51; |
| Length | 550 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CTTCCTTCCTCCATTCCATTCTCCTCTAATCTCACTTCAAATCCAATCAACCCCAAACTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Lipid Metabolism > ko00592 alpha-Linolenic acid metabolism > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko01040 Biosynthesis of unsaturated fatty acids > K00232 acyl-CoA oxidase; Metabolism > Lipid Metabolism > ko00071 Fatty acid metabolism > K00232 acyl-CoA oxidase |
| EC | 1.3.3.6 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 836635 |
| Trichome-related Gene from Literature | N/A |