| Detail of EST/Unigene CX533726 |
| Acc. | CX533726 |
| Internal Acc. | s13dNF0LC09MJ066_320736 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Aldo-keto reductase family 4 member C10 OS=Arabidopsis thaliana E-value=2e-27; Aldo-keto reductase family 4 member C9 OS=Arabidopsis thaliana E-value=6e-27; Aldo-keto reductase family 4 member C11 OS=Arabidopsis thaliana E-value=2e-24; Aldose reductase OS=Homo sapiens E-value=5e-19; Aldo-keto reductase family 4 member C8 OS=Arabidopsis thaliana E-value=6e-19; |
| Length | 258 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CAGCAATCAAATTCTTTCAGTTGAACACTGGTGCTAAAATCCCTTCTGTTGGTTTAGGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00051 Fructose and mannose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00052 Galactose metabolism > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00040 Pentose and glucuronate interconversions > K00011 aldehyde reductase; Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00011 aldehyde reductase; Metabolism > Lipid Metabolism > ko00561 Glycerolipid metabolism > K00011 aldehyde reductase |
| EC | 1.1.1.21 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818356 |
| Trichome-related Gene from Literature | N/A |