Detail of EST/Unigene CX533843 |
Acc. | CX533843 |
Internal Acc. | s13dNF0QD09MJ074_320965 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Probable glutathione S-transferase OS=Nicotiana tabacum E-value=4e-47; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=1e-46; Probable glutathione S-transferase OS=Nicotiana tabacum E-value=9e-46; Probable glutathione S-transferase OS=Solanum tuberosum E-value=7e-44; Glutathione S-transferase U7 OS=Arabidopsis thaliana E-value=1e-42; |
Length | 568 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CAGAGGTGAAACTACACGGATTTTGGTATAGTCCTTATACTTTGAGGGTAGTATGGACCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
EC | 2.5.1.18 |
Transcription Factor Family | |
Transporter Classification Family | 1.A.1 Voltage-gated ion channel superfamily VIC; 1.A.12 Organellar chloride channel O-ClC |
Probeset |
|
Corresponding NCBI Gene | 817491 |
Trichome-related Gene from Literature | N/A |