| Detail of EST/Unigene CX534192 |
| Acc. | CX534192 |
| Internal Acc. | s13dNF0TE03MJ019_322143 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Diaminopimelate decarboxylase 1, chloroplastic OS=Arabidopsis thaliana E-value=2e-69; Diaminopimelate decarboxylase 2, chloroplastic OS=Arabidopsis thaliana E-value=6e-67; Probable diaminopimelate decarboxylase, chloroplastic OS=Oryza sativa subsp. japonica E-value=3e-57; Diaminopimelate decarboxylase OS=Pseudomonas aeruginosa (strain ATCC 15692 / PAO1 / 1C / PRS 101 / LMG 12228) E-value=2e-15; Diaminopimelate decarboxylase OS=Archaeoglobus fulgidus (strain ATCC 49558 / VC-16 / DSM 4304 / JCM 9628 / NBRC 100126) E-value=2e-15; |
| Length | 601 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CACCTCCTCTCCCACTCTTGTTCCCTCCCCAAAACCTTCAATCACTCATTCACCAAAAAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00220 Urea cycle and metabolism of amino groups > K01581 ornithine decarboxylase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K01581 ornithine decarboxylase; Metabolism > Amino Acid Metabolism > ko00300 Lysine biosynthesis > K01586 diaminopimelate decarboxylase |
| EC | 4.1.1.17 4.1.1.20 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 820660 |
| Trichome-related Gene from Literature | N/A |