| Detail of EST/Unigene CX534420 |
| Acc. | CX534420 |
| Internal Acc. | s13dNF0RF03MJ031_322594 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Rac-like GTP-binding protein RHO1 OS=Pisum sativum E-value=1e-37; Rac-like GTP-binding protein ARAC11 OS=Arabidopsis thaliana E-value=2e-37; Rac-like GTP-binding protein ARAC6 OS=Arabidopsis thaliana E-value=3e-37; Rac-like GTP-binding protein RHO1 OS=Beta vulgaris E-value=3e-37; Rac-like GTP-binding protein ARAC1 OS=Arabidopsis thaliana E-value=3e-37; |
| Length | 334 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CAGGATGTGTGATAGTAATTGAAAGAGAAGAAGAAGAAGAAAGTACTGGAGGAGGGGGAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04370 VEGF signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K04392 Ras-related C3 botulinum toxin substrate 1 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 824293 |
| Trichome-related Gene from Literature | N/A |