Detail of EST/Unigene CX534502 |
Acc. | CX534502 |
Internal Acc. | s13dNF47A10MJ081_330712 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glyoxylate reductase OS=Pyrococcus horikoshii (strain ATCC 700860 / DSM 12428 / JCM 9974 / NBRC 100139 / OT-3) E-value=4e-17; Glyoxylate reductase OS=Thermococcus litoralis E-value=5e-17; Glyoxylate reductase OS=Korarchaeum cryptofilum (strain OPF8) E-value=2e-16; Glyoxylate reductase OS=Pyrococcus kodakaraensis (strain ATCC BAA-918 / JCM 12380 / KOD1) E-value=1e-15; Glyoxylate reductase OS=Thermofilum pendens (strain Hrk 5) E-value=3e-15; |
Length | 542 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CTCAAAACCCTAACCCTAATCATGGGATCCATTGGCGTTCTCCTTGTATCTCATCAAGTA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00015 glyoxylate reductase; Metabolism > Carbohydrate Metabolism > ko00630 Glyoxylate and dicarboxylate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K00049 glyoxylate reductase (NADP+); Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K00058 D-3-phosphoglycerate dehydrogenase |
EC | 1.1.1.26 1.1.1.79 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 844326 |
Trichome-related Gene from Literature | N/A |