| Detail of EST/Unigene CX534830 |
| Acc. | CX534830 |
| Internal Acc. | s13dNF19D05MJ042_336064 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Protoporphyrinogen oxidase, chloroplastic OS=Arabidopsis thaliana E-value=5e-54; Protoporphyrinogen oxidase, chloroplastic OS=Nicotiana tabacum E-value=2e-46; Protoporphyrinogen oxidase, chloroplastic OS=Oryza sativa subsp. japonica E-value=4e-45; Protoporphyrinogen oxidase, mitochondrial OS=Nicotiana tabacum E-value=5e-08; Protoporphyrinogen oxidase OS=Propionibacterium freudenreichii subsp. freudenreichii E-value=3e-07; |
| Length | 605 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_JAS_ROOR; |
| Sequence | CCACTTCCACCCGCCATGGTTGCTCTCACCCTCTTTCCACCCACTCAAACCCTTCTCCGC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827991 |
| Trichome-related Gene from Literature | N/A |