Detail of EST/Unigene CX535086 |
Acc. | CX535086 |
Internal Acc. | s13dNF36G12MJ100_388351 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Shaggy-related protein kinase eta OS=Arabidopsis thaliana E-value=1e-69; Shaggy-related protein kinase zeta OS=Arabidopsis thaliana E-value=8e-69; Shaggy-related protein kinase iota OS=Arabidopsis thaliana E-value=2e-68; Shaggy-related protein kinase epsilon OS=Arabidopsis thaliana E-value=3e-63; Shaggy-related protein kinase gamma OS=Arabidopsis thaliana E-value=6e-63; |
Length | 551 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | CTTGTCTTTCCCTTGCTGGGTCCTCCATTCTCTTCTTCTTACTTTCTCTTCCATTCTCTT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Environmental Information Processing > Signal Transduction > ko04012 ErbB signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04340 Hedgehog signaling pathway > K03083 glycogen synthase kinase 3 beta; Environmental Information Processing > Signal Transduction > ko04310 Wnt signaling pathway > K03083 glycogen synthase kinase 3 beta |
EC | 2.7.11.26 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 827605 |
Trichome-related Gene from Literature | 827605 |