Detail of EST/Unigene CX535210 |
Acc. | CX535210 |
Internal Acc. | s13dNF95F10MJ091_388597 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Pisum sativum E-value=8e-60; Chaperonin 60 subunit beta 3, chloroplastic OS=Arabidopsis thaliana E-value=9e-53; RuBisCO large subunit-binding protein subunit beta, chloroplastic OS=Brassica napus E-value=1e-51; Chaperonin 60 subunit beta 2, chloroplastic OS=Arabidopsis thaliana E-value=1e-51; Chaperonin 60 subunit beta 1, chloroplastic OS=Arabidopsis thaliana E-value=4e-50; |
Length | 531 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | AAAACTTATCCAAAACCAAATCCTCTTAAACCCTAGCCACCATTTTCTCCCAATTCCACA |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 835751 |
Trichome-related Gene from Literature | N/A |