Detail of EST/Unigene CX535439 |
Acc. | CX535439 |
Internal Acc. | s13dNF86D03MJ030_389047 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Plastid-lipid-associated protein, chloroplastic OS=Citrus unshiu E-value=8e-36; Chromoplast-specific carotenoid-associated protein, chromoplast OS=Cucumis sativus E-value=4e-34; Plastid lipid-associated protein 1, chloroplastic OS=Brassica campestris E-value=9e-34; Light-induced protein, chloroplastic OS=Solanum tuberosum E-value=3e-33; Light-induced protein, chloroplastic OS=Solanum demissum E-value=3e-33; |
Length | 524 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_JAS_ROOR; |
Sequence | AAACACTCTTCCAGTAACCTCTCTCAACTCCACACCTTCAATTTCTCCGTCGACCATCAC |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 825714 |
Trichome-related Gene from Literature | N/A |