| Detail of EST/Unigene DB681001 |
| Acc. | DB681001 |
| Internal Acc. | DB681001 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | MADS-box protein JOINTLESS OS=Solanum lycopersicum E-value=1e-08; MADS-box protein SVP OS=Arabidopsis thaliana E-value=6e-08; MADS-box protein AGL24 OS=Arabidopsis thaliana E-value=3e-07; |
| Length | 100 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_MicroLEAF3; |
| Sequence | CTCCTAAGGGCTAGAGAAAAAATTCAGATCAAGAAAATAGATAACTCCCCAGCAAGACAA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | MIKC |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 816787 |
| Trichome-related Gene from Literature | 816787 |