| Detail of EST/Unigene DB695970 |
| Acc. | DB695970 |
| Internal Acc. | DB695970 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | E3 ubiquitin-protein ligase COP1 OS=Arabidopsis thaliana E-value=1e-26; E3 ubiquitin-protein ligase COP1 OS=Pisum sativum E-value=2e-26; Postreplication repair E3 ubiquitin-protein ligase RAD18 OS=Candida glabrata (strain ATCC 2001 / CBS 138 / JCM 3761 / NBRC 0622 / NRRL Y-65) E-value=1e-08; E3 ubiquitin-protein ligase RFWD2 OS=Homo sapiens E-value=2e-08; Postreplication repair E3 ubiquitin-protein ligase RAD18 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=2e-08; |
| Length | 364 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_MicroLEAF3; |
| Sequence | GTTGTTTGGGGTTGAGGGGTAGTTGATTATTGAAAAATACCCAATTTGCAGTTGGGGGTA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K03175 TNF receptor-associated factor 6; Environmental Information Processing > Signal Transduction > ko04010 MAPK signaling pathway > K03175 TNF receptor-associated factor 6; Genetic Information Processing > Folding, Sorting and Degradation > ko04120 Ubiquitin mediated proteolysis > K10143 E3 ubiquitin-protein ligase RFWD2 |
| EC | 6.3.2.19 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 817857 |
| Trichome-related Gene from Literature | 817857 |