| Detail of EST/Unigene DB703664 |
| Acc. | DB703664 |
| Internal Acc. | DB703664 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cysteine synthase OS=Solanum tuberosum E-value=2e-89; Cysteine synthase OS=Spinacia oleracea E-value=4e-82; Cysteine synthase OS=Citrullus lanatus E-value=5e-82; Cysteine synthase OS=Brassica juncea E-value=5e-80; Cysteine synthase OS=Brassica juncea E-value=1e-79; |
| Length | 571 nt |
| Species | Solanum lycopersicum |
| Belonged EST Libraries | SL_MicroLEAF3; |
| Sequence | AAGCACAGTAGATTTCATTTCTTGTCTTTGTCAAATCCTAGAATCAACCTGATAATATGG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Amino Acid Metabolism > ko00260 Glycine, serine and threonine metabolism > K01697 cystathionine beta-synthase; Metabolism > Amino Acid Metabolism > ko00271 Methionine metabolism > K01697 cystathionine beta-synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01697 cystathionine beta-synthase; Metabolism > Energy Metabolism > ko00920 Sulfur metabolism > K01738 cysteine synthase; Metabolism > Amino Acid Metabolism > ko00272 Cysteine metabolism > K01738 cysteine synthase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K01738 cysteine synthase |
| EC | 2.5.1.47 4.2.1.22 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 827145 |
| Trichome-related Gene from Literature | 827145 |