Detail of EST/Unigene DB714665 |
Acc. | DB714665 |
Internal Acc. | DB714665 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Gamma-glutamyltranspeptidase 1 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-30; Gamma-glutamyltranspeptidase 1 OS=Rattus norvegicus E-value=8e-28; Gamma-glutamyltranspeptidase 1 OS=Mus musculus E-value=3e-27; Gamma-glutamyltranspeptidase 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=7e-27; Gamma-glutamyltranspeptidase 1 OS=Homo sapiens E-value=4e-25; |
Length | 703 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroFRUIT; |
Sequence | GTGGAGAAACATAATTTGGAAGCTCCACTTTTGGACTCTACTTCTCCTCTTTGTTCTAAT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Lipid Metabolism > ko00590 Arachidonic acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00460 Cyanoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00450 Selenoamino acid metabolism > K00681 gamma-glutamyltranspeptidase; Metabolism > Metabolism of Other Amino Acids > ko00430 Taurine and hypotaurine metabolism > K00681 gamma-glutamyltranspeptidase |
EC | 2.3.2.2 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 829042 |
Trichome-related Gene from Literature | 829042 |