Detail of EST/Unigene DB721685 |
Acc. | DB721685 |
Internal Acc. | DB721685 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Glutamate--cysteine ligase, chloroplastic OS=Solanum lycopersicum E-value=1e-97; Glutamate--cysteine ligase, chloroplastic OS=Nicotiana tabacum E-value=9e-81; Glutamate--cysteine ligase, chloroplastic OS=Arabidopsis thaliana E-value=1e-55; Glutamate--cysteine ligase, chloroplastic OS=Brassica juncea E-value=8e-55; Glutamate--cysteine ligase, chloroplastic OS=Medicago truncatula E-value=4e-49; |
Length | 718 nt |
Species | Solanum lycopersicum |
Belonged EST Libraries | SL_MicroFRUIT; |
Sequence | GATAAAGCTCTAGCCGCCTCAGCACACCAAAATCCTAATCATTTTGCTGATACCCAATTG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 828409 |
Trichome-related Gene from Literature | 828409 |