| Detail of EST/Unigene DQ394574 |
| Acc. | DQ394574 |
| Internal Acc. | |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 77A3 OS=Glycine max E-value=4e-87; Cytochrome P450 77A2 OS=Solanum melongena E-value=4e-85; Cytochrome P450 77A4 OS=Arabidopsis thaliana E-value=2e-84; Cytochrome P450 77A1 (Fragment) OS=Solanum melongena E-value=7e-83; Cytochrome P450 89A2 OS=Arabidopsis thaliana E-value=6e-52; |
| Length | 1218 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_CDS; |
| Sequence | GGCACGAGGAATTACTCTTCTACTACTATTACTATTATCATCTTTCTTTCTATCTATCCT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Biosynthesis of Secondary Metabolites > ko00232 Caffeine metabolism > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07409 cytochrome P450, family 1, subfamily A, polypeptide 2; Metabolism > Lipid Metabolism > ko00591 Linoleic acid metabolism > K07 |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 837704 |
| Trichome-related Gene from Literature | N/A |