| Detail of EST/Unigene DV159556 |
| Acc. | DV159556 |
| Internal Acc. | KP1B.037M01F.050623T7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein type 2 member 1B, chloroplastic OS=Pinus sylvestris E-value=3e-09; Chlorophyll a-b binding protein 1A, chloroplastic OS=Pyrus pyrifolia E-value=3e-09; Chlorophyll a-b binding protein type 2 member 1A, chloroplastic OS=Pinus sylvestris E-value=3e-09; Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=3e-09; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=3e-09; |
| Length | 261 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KP1BS; |
| Sequence | GGAAAACCTTGCCGATCATCTTGCAGACCCAGTTAATAACAACGCATGGGCCTACGCCAC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |