| Detail of EST/Unigene DV160916 |
| Acc. | DV160916 |
| Internal Acc. | KP1B.104J03F.050725T7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Glutathione S-transferase F11 OS=Arabidopsis thaliana E-value=3e-50; Glutathione S-transferase OS=Hyoscyamus muticus E-value=4e-50; Glutathione S-transferase F8, chloroplastic OS=Arabidopsis thaliana E-value=4e-50; Glutathione S-transferase APIC OS=Nicotiana tabacum E-value=1e-48; Glutathione S-transferase PARB OS=Nicotiana tabacum E-value=1e-48; |
| Length | 915 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KP1BS; |
| Sequence | ACAAAGAAGGAACAAAACCCGCTACTTTCTTGATTTTTATGTAGCTTTTTCAGATGGCTT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K00799 glutathione S-transferase; Metabolism > Metabolism of Other Amino Acids > ko00480 Glutathione metabolism > K00799 glutathione S-transferase |
| EC | 2.5.1.18 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821227 |
| Trichome-related Gene from Literature | N/A |