| Detail of EST/Unigene DV161782 |
| Acc. | DV161782 |
| Internal Acc. | KP1B.109C16F.050727T7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Phosphoenolpyruvate carboxylase OS=Solanum tuberosum E-value=0; Phosphoenolpyruvate carboxylase 2 OS=Flaveria trinervia E-value=0; Phosphoenolpyruvate carboxylase OS=Nicotiana tabacum E-value=0; Phosphoenolpyruvate carboxylase 1 OS=Arabidopsis thaliana E-value=0; Phosphoenolpyruvate carboxylase 2 OS=Mesembryanthemum crystallinum E-value=0; |
| Length | 816 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KP1BS; |
| Sequence | AGAGGAAGCAACGTATACTAGTATTGAGCAGTTCTTGGAACCTCTTGAGCTCTGCTACAG |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01595 phosphoenolpyruvate carboxylase |
| EC | 4.1.1.31 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 841765 |
| Trichome-related Gene from Literature | 841765 |