Detail of EST/Unigene DV161782 |
Acc. | DV161782 |
Internal Acc. | KP1B.109C16F.050727T7 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Phosphoenolpyruvate carboxylase OS=Solanum tuberosum E-value=0; Phosphoenolpyruvate carboxylase 2 OS=Flaveria trinervia E-value=0; Phosphoenolpyruvate carboxylase OS=Nicotiana tabacum E-value=0; Phosphoenolpyruvate carboxylase 1 OS=Arabidopsis thaliana E-value=0; Phosphoenolpyruvate carboxylase 2 OS=Mesembryanthemum crystallinum E-value=0; |
Length | 816 nt |
Species | Nicotiana tabacum |
Belonged EST Libraries | NT_KP1BS; |
Sequence | AGAGGAAGCAACGTATACTAGTATTGAGCAGTTCTTGGAACCTCTTGAGCTCTGCTACAG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | Metabolism > Carbohydrate Metabolism > ko00620 Pyruvate metabolism > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00710 Carbon fixation in photosynthetic organisms > K01595 phosphoenolpyruvate carboxylase; Metabolism > Energy Metabolism > ko00720 Reductive carboxylate cycle (CO2 fixation) > K01595 phosphoenolpyruvate carboxylase |
EC | 4.1.1.31 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 841765 |
Trichome-related Gene from Literature | 841765 |