| Detail of EST/Unigene DW000787 |
| Acc. | DW000787 |
| Internal Acc. | KL4B.108O11F.051105T7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Cytochrome P450 750A1 OS=Pinus taeda E-value=2e-42; Cytochrome P450 71A22 OS=Arabidopsis thaliana E-value=7e-38; Cytochrome P450 71A24 OS=Arabidopsis thaliana E-value=5e-37; Cytochrome P450 71A16 OS=Arabidopsis thaliana E-value=1e-36; Psoralen synthase (Fragment) OS=Apium graveolens E-value=2e-36; |
| Length | 893 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KL4B; |
| Sequence | TAGCAAAAAGGGGCTGTGAATTCCATCCATGGCTTCTCTTTGGCTAGCTCTTGCAGTAGT |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Metabolism > Xenobiotics Biodegradation and Metabolism > ko00980 Metabolism of xenobiotics by cytochrome P450 > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Amino Acid Metabolism > ko00380 Tryptophan metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Metabolism of Cofactors and Vitamins > ko00830 Retinol metabolism > K07408 cytochrome P450, family 1, subfamily A, polypeptide 1; Metabolism > Xenobiotics Biodegradation and Metabolism > ko00982 Drug metabolism - cytochrome P450 > K07414 cytochrome P450, family 2, subfamily D |
| EC | 1.14.14.1 |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 823989 |
| Trichome-related Gene from Literature | N/A |