| Detail of EST/Unigene DW000886 |
| Acc. | DW000886 |
| Internal Acc. | KL4B.109E05F.051105T7 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Chlorophyll a-b binding protein M9, chloroplastic OS=Zea mays E-value=5e-13; Chlorophyll a-b binding protein 40, chloroplastic OS=Nicotiana tabacum E-value=5e-13; Chlorophyll a-b binding protein C, chloroplastic OS=Nicotiana plumbaginifolia E-value=5e-13; Chlorophyll a-b binding protein 21, chloroplastic OS=Nicotiana tabacum E-value=5e-13; Chlorophyll a-b binding protein 2, chloroplastic OS=Oryza sativa subsp. japonica E-value=5e-13; |
| Length | 280 nt |
| Species | Nicotiana tabacum |
| Belonged EST Libraries | NT_KL4B; |
| Sequence | TCACCGGAAAGGGTCCATTGGAAAACCTTGCCGATCATCTTGCAGACCCAGTTAATAACA |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 818005 |
| Trichome-related Gene from Literature | N/A |