Detail of EST/Unigene DW015095 |
Acc. | DW015095 |
Internal Acc. | EST1224056 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Arabidopsis thaliana E-value=3e-13; Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Arabidopsis thaliana E-value=5e-11; Oxygen-evolving enhancer protein 3, chloroplastic OS=Spinacia oleracea E-value=2e-10; Oxygen-evolving enhancer protein 3-2, chloroplastic OS=Zea mays E-value=2e-08; Oxygen-evolving enhancer protein 3-1, chloroplastic OS=Zea mays E-value=4e-08; |
Length | 798 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | GCACTTCCCAAATGGATATGTCACAAATTTTTTATTTCCAAAAACTTTAATGAATTATCT |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 821143 |
Trichome-related Gene from Literature | N/A |