Detail of EST/Unigene DW015242 |
Acc. | DW015242 |
Internal Acc. | EST1224203 |
Type | EST |
Annotation (Top 5 hits in Uniprot_trembl) | Ferredoxin--NADP reductase, leaf isozyme, chloroplastic OS=Pisum sativum E-value=4e-90; Ferredoxin--NADP reductase, chloroplastic OS=Vicia faba E-value=4e-89; Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic OS=Arabidopsis thaliana E-value=3e-86; Ferredoxin--NADP reductase, chloroplastic OS=Spinacia oleracea E-value=1e-85; Ferredoxin--NADP reductase, chloroplastic OS=Mesembryanthemum crystallinum E-value=4e-85; |
Length | 689 nt |
Species | Medicago truncatula |
Belonged EST Libraries | MT_FLOSEED_MTY; |
Sequence | AGAAATGCTTATGCCAAAAGATCCAAATGCCACCGTCATCATGTTGGGAACTGGTACTGG |
EST members of Unigene | N/A |
InterProScan Domain | |
Gene Ontology | |
KEGG Orthology | |
EC | 1.16.1.8 |
Transcription Factor Family | |
Transporter Classification Family | |
Probeset |
|
Corresponding NCBI Gene | 836751 |
Trichome-related Gene from Literature | N/A |