| Detail of EST/Unigene DW015279 |
| Acc. | DW015279 |
| Internal Acc. | EST1224240 |
| Type | EST |
| Annotation (Top 5 hits in Uniprot_trembl) | Replication factor A protein 2 OS=Schizosaccharomyces pombe (strain 972 / ATCC 24843) E-value=6e-16; Replication factor A protein 2 OS=Saccharomyces cerevisiae (strain ATCC 204508 / S288c) E-value=3e-09; |
| Length | 865 nt |
| Species | Medicago truncatula |
| Belonged EST Libraries | MT_FLOSEED_MTY; |
| Sequence | GGGAAACCAATTATTTAGATATTAAATATCGACACAGCGAAATGTGAAATTCGAAATTTC |
| EST members of Unigene | N/A |
| InterProScan Domain | |
| Gene Ontology | |
| KEGG Orthology | Genetic Information Processing > Replication and Repair > ko03030 DNA replication > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03440 Homologous recombination > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03430 Mismatch repair > K10739 replication factor A2; Genetic Information Processing > Replication and Repair > ko03420 Nucleotide excision repair > K10739 replication factor A2 |
| EC | |
| Transcription Factor Family | |
| Transporter Classification Family | |
| Probeset |
|
| Corresponding NCBI Gene | 821187 |
| Trichome-related Gene from Literature | N/A |